bash - remove the first 15 characters from every other line in a file -


i have txt files (they contain dna sequences , sample codes):

>srr1502445.1 gactacacgtagtatacgagtgcgttcctgcgcttattgatatgcttaagttcagcgggtagtctcacccgatttgaggtcaaggtttgtgggtcgagtcacaactcgaacatcgtctttgtacaaagacggttggaagcgggttccaaggcaacacagggggataggnnnnnnnnnnnnnnnnnnnnnnn >srr1502445.2 gactacacgtagtatacgagtgcgttcctgcgcttattgatatgcttaagttcagcgggtagtctcacccgatttgaggtcaaggtttgtgggtcgagtcacaactcgaacatcgtctttgtacaagacggttggaagcgggttccaaggcacacaggggataggnnn >srr1502445.3 gactacacgtagtatacgagtgcgttcctgcgcttattgatatgcttaagttcagcgggtagtctcacccgatttgaggtcaaggtttgtgggtcgagtcacaactcgaacatcgtctttgtacaaagacggttggaagcgggttccaaggcacacaggggataggnnn >srr1502445.4 gactacacgtagtatacgagtgcgttcctgcgcttattgatatgcttaagttcagcgggtagtctcacccgatttgaggtcaaggtttgtgggtcgagtcacaactcgaacatcgtctttgtacaaagacggttggaagcgggttccaaggcacacaggggataggnnnnnnnnnnn

i remove first 15 characters of every other line in file. remove string gactacacgtagtat second, fourth, sixth, eighth lines (etc).

for instance cut command can remove first 15characters of every line:

cut -c 1-15 /path/to/file.txt

i'd apply to every other line, starting second.

if don't mind using sedand assuming other line starts > following remove first 15 contiguous uppercase characters "a-z" of other lines:

sed 's/^[a-z]\{15\}//' file > new_file

or, in place edit (gnu sed) use -i:

sed -i 's/^[a-z]\{15\}//' file

or, in place edit (bsd sed) use -i '':

sed -i '' 's/^[a-z]\{15\}//' file

or, up:

sed -i.bak 's/^[a-z]\{15\}//' file

example:

$ cat file >srr1502445.1 gactacacgtagtatacgagtgcgttcctgcgcttattgatatgcttaagttcagcgggtagtctcacccgatttgaggtcaaggtttgtgggtcgagtcacaactcgaacatcgtctttgtacaaagacggttggaagcgggttccaaggcaacacagggggataggnnnnnnnnnnnnnnnnnnnnnnn >srr1502445.2 gactacacgtagtatacgagtgcgttcctgcgcttattgatatgcttaagttcagcgggtagtctcacccgatttgaggtcaaggtttgtgggtcgagtcacaactcgaacatcgtctttgtacaagacggttggaagcgggttccaaggcacacaggggataggnnn >srr1502445.3 gactacacgtagtatacgagtgcgttcctgcgcttattgatatgcttaagttcagcgggtagtctcacccgatttgaggtcaaggtttgtgggtcgagtcacaactcgaacatcgtctttgtacaaagacggttggaagcgggttccaaggcacacaggggataggnnn >srr1502445.4 gactacacgtagtatacgagtgcgttcctgcgcttattgatatgcttaagttcagcgggtagtctcacccgatttgaggtcaaggtttgtgggtcgagtcacaactcgaacatcgtctttgtacaaagacggttggaagcgggttccaaggcacacaggggataggnnnnnnnnnnn $ sed 's/^[a-z]\{15\}//' file >srr1502445.1 acgagtgcgttcctgcgcttattgatatgcttaagttcagcgggtagtctcacccgatttgaggtcaaggtttgtgggtcgagtcacaactcgaacatcgtctttgtacaaagacggttggaagcgggttccaaggcaacacagggggataggnnnnnnnnnnnnnnnnnnnnnnn >srr1502445.2 acgagtgcgttcctgcgcttattgatatgcttaagttcagcgggtagtctcacccgatttgaggtcaaggtttgtgggtcgagtcacaactcgaacatcgtctttgtacaagacggttggaagcgggttccaaggcacacaggggataggnnn >srr1502445.3 acgagtgcgttcctgcgcttattgatatgcttaagttcagcgggtagtctcacccgatttgaggtcaaggtttgtgggtcgagtcacaactcgaacatcgtctttgtacaaagacggttggaagcgggttccaaggcacacaggggataggnnn >srr1502445.4 acgagtgcgttcctgcgcttattgatatgcttaagttcagcgggtagtctcacccgatttgaggtcaaggtttgtgggtcgagtcacaactcgaacatcgtctttgtacaaagacggttggaagcgggttccaaggcacacaggggataggnnnnnnnnnnn $

-

Comments

Post a Comment

Popular posts from this blog

apache - PHP Soap issue while content length is larger -

we have developed soap based webservice post data third party webservice. accepts 4 params. in 1 of parameters accepts xml string no size limit restriction put in place. the webservice works fine in local environment running on php 5.2 , apache2. works content length long 10 mb. in staging server running nginx , php fpm.we have updated max post size , max upload filesize in php.ini , client_max_body param in nginx.conf allow upto 50 mb. but webservice client keeps on loading in staging environment. gives 502 timeout , gives soap error. can me understand issue here?
Read more

asynchronous - Python asyncio task got bad yield -

i confused how play around asyncio module in python 3.4. have searching api search engine, , want each search request run either parallel, or asynchronously, don't have wait 1 search finish start another. here high-level searching api build objects raw search results. search engine using kind of asyncio mechanism, won't bother that. # no asyncio module used here class search(object): ... self.s = some_search_engine() ... def searching(self, *args, **kwargs): ret = {} # raw searching according args , kwargs , build wrapped results ... return ret to try async requests, wrote following test case test how can interact stuff asyncio module. # here testing script @asyncio.coroutine def handle(f, *args, **kwargs): r = yield f(*args, **kwargs) return r s = search() loop = asyncio.get_event_loop() loop.run_until_complete(handle(s.searching, arg1, arg2, ...)) loop.close() by running pytest, return runtimeerror: task got bad yield : {results s...
Read more

javascript - Complete OpenIDConnect auth when requesting via Ajax -

the normal openidconnect server works like: you go a.com/secure-resource you 302 server your browser handles , sends identity server you login there it sends a.com via post you logged in on a.com , a.com/secure-resource on browser. however have scenario i'm trying solve need help. the user logged in on idserver the user logged in on a.com the user not logged in on b.com we need send ajax call web server b.com (from domain a.com ) b.com configured use openidconnect. but because request b.com via ajax, user cannot redirected idserver. (all in response 302 ) we can go ahead , handle 302 via ajax (i'm still not sure whether work, security-wise). but is there scenario in identityserver/openidconnect designed these situations? with identityserver in scenario setup server b.com use bearer token authentication, need use access token provided a.com in headers of ajax call $.ajax({ url: 'http://b.com', headers: { ...
Read more